An Opportunistic Pantoea sp. Isolated from a Cotton Fleahopper That Is Capable of Causing Cotton

An Opportunistic Pantoea sp. Isolated from a Cotton Fleahopper That Is Capable of Causing Cotton (Gossypium hirsutum L.) Bud Rot

Enrique G. Medrano*, Alois A. Bell

Abstract

Pantoea ananatis (Serrano) representatives are known to have a broad host

range including both humans and plants. The cotton fleahopper (Pseudatomoscelis

seriatus, Reuter) is a significant pest that causes cotton bud damage

that may result in significant yield losses. In this study, a bacterial strain previously

isolated from a fleahopper was tested for cotton infectivity using simulated

insect feeding. In addition, cotton fleahoppers collected from the

field were raised on green beans in the laboratory to test the insects’ capacity

to vector cotton pathogens. Adult insects were then caged with greenhouse

grown cotton buds. Buds that remained or abscised from the plants following

feeding by the insect consistently showed necrosis of the ovary including the

wall. A collection of bacterial isolates from both caged insects and diseased

buds was analyzed using carbon utilization and enzyme production tests, fatty

acid methyl ester profile analysis, and by cloning and sequencing 16S RNA

genes. Results showed that the majority of the isolates were best classified as P.

ananatis. Upon simulated fleahopper feeding (i.e., penetrative inoculation),

the fleahopper isolate rotted cotton buds. These results indicated the fleahoppers

are vectors of opportunistic P. ananatis strains causing loss of the cotton

fruiting structures.

Keywords

Bud Abscission, Opportunistic Pathogens, Gossypium hirsutum

1. Introduction

Pantoea ananatis (Serrano) is a Gram negative bacterium that includes strains

capable of residing as part of normal microbial flora or infecting various hosts.

Reports of both human and plant pathogenic strains are well documented [1]. In plant pathology, P. ananatis can inflict disease in both monocots and dicots.

Studies focused on the potential of cotton fleahoppers (Pseudatomoscelis seriatus

Reuter) to vector plant pathogenic P. ananatis into cotton are limited in documentation.

In research towards dissecting the mechanisms employed by cotton

fleahoppers to inflict damage to cotton fruit, we putatively identified P. ananatis

as the main culprit of disease following insect feeding.

Cotton fleahoppers and other pests that feed via a piercing-sucking mechanism

have become significant pests of cotton. In 1999, the cotton fleahopper was

ranked as the top cause of cotton yield losses, primarily because of severe losses

in Texas in that year [2]. In 2004, these insects were ranked among the top five

insect causes of cotton yield losses: Lygus bug (Hahn), #2; stink bugs (Leach), #3;

and cotton fleahopper, #5 [3]. More recently, the cotton fleahopper has held its

significance as a cotton pest ranking 5th in 2014 [4].

An association between fleahoppers and plant pathogen transmission into

cotton flower and leaf buds (i.e., squares) resulting in disease has been suggested

by Martin et al. [5]. Subsequent infections cause ethylene bursts resulting in abscission

of buds and young bolls. Cotton fleahoppers are infested with various

fungi and with bacteria putatively identified as Xanthomonas and Pseudomonas

spp. [6] [7] [8]. Unfortunately, criteria for the identification of the bacteria were

not provided. The microorganisms were isolated from salivary glands as well as

whole insects. Martin et al. [9] reported that fleahoppers fed 5% sucrose that

contained Xanthomonas campestris pv. malvacearum both acquired and subsequently

transmitted the bacterium to cotton plants causing disease symptoms on

leaves and stems. Terminal bud explants of cotton planted in agar in 25-ml flasks

showed a burst in ethylene production when infested with fleahoppers, or when

inoculated with microorganisms associated with the insect [5] [6] [7]. Pectinase

preparations from salivary glands also caused a burst in ethylene synthesis [10].

Ethylene bursts are symptomatic of tissue necrosis incited by microbial infections

of plant tissues [11] [12].

Cotton fleahoppers are known to occur throughout the Cotton Belt yet, losses

generally occur mostly in Texas followed by Oklahoma, Louisiana, Kansas, and

Arizona. This is probably due to the fact that the insects generally prefer weed

hosts and move to cotton only when satisfactory weed hosts are not available

[13]. In Central Texas, the insect overwinters primarily as eggs inserted into

stems of croton (Croton capitatus Michaux), its preferred fall host [14]. When

nymphs hatch in the spring, they move to weeds such as horsemint (Monarda

punctata L.). Later generations move to cotton in June when the horsemint and

other spring weeds begin to senesce. Once cotton ceases to flower, fleahoppers

move back to croton for late summer and fall generations.

Bell et al. [14] characterized generally the microorganisms associated with

cotton fleahoppers and provided evidence for their involvement in leaf and

flower bud abscission. The insects were collected from two weed hosts, horsemint

(Monarda punctata L.) and croton, and cotton (Gossypium hirsutum L.) at

seven intervals during the 2005 cotton growing season in Texas. Most fleahop-pers yielded sufficient bacteria, when washed in sterile water, to cause severe

seed rot and internal boll rot of 13 to 15 d cotton bolls puncture inoculated with

the wash water. Initial efforts to identify the Pantoea isolates to species did not

render clear results.

In this study, we used a bacterial strain isolated from a fleahopper in simulated

insect feeding transmission experiments to test for cotton infectivity. Pantoea

species have been distinguished by numerical taxonomy using API systems

[15], fatty acid profiles [16] [17], and 16S ribosomal DNA (rDNA) sequence

analyses [18] [19]. Here, we employed all of these techniques to characterize

Pantoea isolates from laboratory reared insects and diseased buds resulting from

feeding of these insects. The likelihood that the cotton fleahopper is actually capable

of transmitting cotton pathogens is also discussed

2. Materials and Methods
2.1. Simulated Fleahopper Feeding Studies

Strain CFH 7-1R was previously isolated from a field collection of cotton fleahoppers

[14]. The strain was determined to be a natural variant resistant to Rif.

Bacterial suspensions of strain CFH 7-1R in sterile distilled water were prepared

from 18 h cultures and adjusted spectrophotometrically (A600 = 0.5). Using a

31-gauge needle and syringe (Becton, Dickson and Comp. Sparks, MD) 10 µl of

the appropriate dilution (103 cells) were separately inoculated into flower buds

(i.e., 3 - 7 mm wide squares) to simulated fleahopper feeding puncture. The buds

were punctured to a depth of 1 - 2 mm through the ovary. Mock inoculations

consisted of injections of an equal volume of sterile distilled water. Buds were

harvested 1 wk following the inoculations, surface sterilized using 70% ethanol

and then rinsed in sterile water. Using a sterile scalpel, the buds were longitudinally

sectioned to observe for any damage. Embryo tissue (ca. 1.0 g) was transferred

into a 1.1 ml micro-tube that contained 0.5 ml PO4 buffer (0.1 mol, pH

7.1) and a sterile 4 mm stainless steel ball. A second 4 mm stainless steel ball was

added, and the tissue was ground using a 2000 Geno/Grinder (SPEX SamplePrep,

Metuchen, NJ, USA) for 5 min at 1500 strokes per min then 10-fold dilution

(PO4 buffer) plated on both Trypticase Soy Agar (TSA, Sigma Aldrich, St.

Louis, MO) and TSA amended with Rif (100 μg/ml). Tissue from embryos injected

with water only was processed as negative controls. After two days of incubation

at 28˚C, bacterial colonies were enumerated and recorded as colony

forming units (CFU)/g tissue.

2.2. Caging Insects with Cotton

Deltapine 493 plants were grown from seeds in the greenhouse under a rigid insect

control regime following methods described in Medrano et al. [20]. The cultivar

possesses normal cotton leaves, is non-trangenic (i.e., no BT genes) and

matures by mid-season. The planting mixture consisted of 18 l washed sand, 12 l

vermiculite, 12 l dried peat moss, 1 l gypsum, 300 ml dolomitic lime and 50 ml

esmigran (Scotts-Sierra Horticultural Products Co., Marysvillee, OH, USA). Themixture was distributed into 0.5 kg plastic pots, saturated with reverse-osmosis

water, and then pasteurized using aerated steam (74˚C) for 16 h. Seedlings

started in germination towels (48 h at 30˚C) were transplanted into the planting

mixture. Glasshouse cooling and heating thermostats were set at 30 and 20˚C

respectively. Weekly, plants received 150 mg Peter’s Peat-Lite Special 15-16-17

containing chelated minor elements (Scotts-Sierra Horticultural Products Co.,

Marysvillee, OH, USA).

Fleahopper eggs (embedded in croton stems) were collected from croton fields

in Brazos County, TX, USA (coordinates 30.59450˚N, 96.52081˚W) near the city

of College Station. The insects were reared in the laboratory using methods detailed

in Beerwinkle and Marshall [13]. Insects were provided green beans (Phaseolus

vulgaris L.) that had first been washed in a 5% sodium bicarbonate solution.

The beans were replenished every two to three days. For microbe transmission

testing, adults were caged over fruiting branches using a styrofoam cylinder

enclosed with a section of nylon mesh hose fitted over the cylinder and fruiting

branch stem and tied at both ends after three fleahoppers were placed in a cage

constructed using methods described in Medrano et al. [21]. After 7 d the insects

were removed from the cages and harvested (see Isolation of Microorganisms

from Insects and Cotton). Seven days later flower buds that were retained on the

fruiting branches were harvested, surface sterilized in 70% ethanol, rinsed in sterile

water, sectioned longitudinally with a sterile scalpel, and examined for tissue

necrosis in the anthers, stigma, and ovary. Both insects and sectioned tissues

from individual cages were tested separately for the presence of bacteria (see

Isolation of Microorganisms from Insects and Cotton).

2.3. Isolation of Microorganisms from Insects and Cotton

Following the caging period, each surviving insect was aseptically placed in 70%

ethanol, agitated periodically (3X) with a vortex mixer (5 s) and then rinsed in

sterile water. The insects were then placed into a 1.1 mL microtube (SPEX SamplePrep,

Metuchen, NJ, USA) that contained 0.5 mL PO4 buffer (0.125 M, pH

7.1) and a sterile 4 mm stainless steel ball (SPEX SamplePrep, Metuchen, NJ,

USA). After adding an identical steel ball and capping, the tubes were placed in a

96 tube-rack for crushing. Pulverization of the insects consisted 1500 strokes/min

for 5 min using a 2000 Geno/Grinder (SPEX SamplePrep, Metuchen, NJ, USA),

and then 10-fold dilution (PO4 buffer) plated on both TSA, and TSA amended

with Rif. Following two days incubation at 28˚C, microbe colonies were counted

and expressed as CFU/mg insect. The buds were processed as described above

(see Simulated Fleahopper Feeding Studies). Single bacterial colonies of different

types of bacteria from separate insects or buds were used for identification and

to test pathogenicity and virulence with an emphasis given to the most prevalent

bacterial colony type from a sample.

2.4. Characterization of Bacteria

Remote colonies of bacteria that were isolated, purified, inoculated, and then recovered from diseased buds were used for characterization and/or identification.

Colony morphology was observed on TSA, King’s B-pectin agar (KBP), and

potato dextrose agar containing 0.8 g/l of fine CaCO3 (PDAC). Anaerobic

growth was determined on a medium containing peptone, 2.0 g; NaCl, 5.0 g;

KH2PO4, 0.3 g; agar, 3.0 g; bromothymol blue (1% aqueous solution), 3.0 ml;

glucose, 1.0 g; and water 1 l. Ingredients were dissolved with minimal heat

(55˚C), and 5 ml of solution was dispensed into 13 ml glass tubes before sterilizing

at 121˚C and 15 psi for 15 min. The tubes were stabbed with 18 h bacterial

paste cultures using a sterile plastic probe (Argo Technologies, Elgin IL), and the

medium was covered immediately with sterile mineral oil (Sigma-Aldrich, St.

Louis, MO). Anaerobes acidified the medium within 4 to 8 h at 30˚C; tubes were

scored for anaerobic growth after 24 h. The phenotypic tests were performed

using protocols described by Schaad et al. [22]. Representative isolates of different

groups of bacteria determined from the above criteria were submitted to the

Texas Plant Disease Diagnostic Laboratory for fatty acid methyl ester (FAME)

profile analysis. Possible species identification was determined by best fit Similarities

(SIM index) test to the database for bacteria, Sherlock Version 4.5

(0209B); TSBA 40 4.10. Gram negative isolates that grew anaerobically also were

tested with the API 20E strip (Biomérieux, Hazlewood, MO) to determine putative

species identification. Control bacteria for all characterization tests included

the type strains for P. ananatis (ATCC 33244) and P. agglomerans (ATCC

27155).

2.5. 16S Ribosomal DNA Sequencing

A universal degenerate primer set (16sFXbaI—5’ GGTCTAGAAGAGTTTGATCMTGG

CTCAG 3’; 16sRNotI—5’ CGGCGGCCGCACGGGCGGTGTGTACA

3’) was used to amplify a 16S rDNA Polymerase Chain Reaction (PCR) product

[20]. The 1.5 K base pair approximate PCR product that was predicted based on

E. coli positioning was ligated into the XbaI/NotI sites of the pDrive cloning

vector (New England Biolabs Inc., Beverly, MA) and then transformed into E.

coli strain ER2267 (New England Biolabs Inc., Beverly, MA) by CaCl2 transformation

[23]. A Qiagen kit (Valencia, CA) was used for all PCR experiments with

an amplification protocol that consisted of an initial denaturation step at 96˚C

for 5 min, followed by 30 cycles of denaturation at 95˚C for 1 min, annealing at

55˚C for 1 min, extension at 72˚C for 1 min, and then a final extension at 72˚C

for 5 min using a PTC-200 DNA Engine Cycler (MJ Research Inc., Waltham,

MA). Sequencing was performed at the Institute of Developmental and Molecular

Biology, Gene Technologies Laboratory at Texas A&M University (College

Station, TX). The derived 16S rDNA gene sequence data from both strands was

edited and assembled using Sequencher 4.8. The generated 16S rDNA sequences

from the isolates were compared with type strains (NCBI Accession numbers in

parenthesis) for several α subclass of the Proteobacteria species including Pantoea

ananatis ATCC 33244 (U80196), Pantoea agglomerans ATCC 27155 (NR_

114735), Pantoea stewartii ATCC 8199 (U80208), Klebsiella oxytoca ATCC 13182 (NR_119277.1), Serratia marcescens ATCC 13880 (AB681729.1), Pseudomonas

putida ATCC 12633 (AJ308313), and Burkholderia cepacia ATCC

25416 (AB680546). The phylogenetic analysis was performed using MEGA6

[24]. Juke-Cantor distances were calculated and a tree was constructed using the

Unweighted Pair Group Method with Average (UPGMA). The tree was constructed

to scale, with branch lengths (above the branches) in the same units as

those of the evolutionary distances used to infer the phylogenetic tree. Bootstrapping

was done for 1000 replicates with confidence levels greater 50% indicated

at the tree internodes

3. Results and Discussion
3.1. Simulated Cotton Fleahopper Feeding Studies

A total of 50 buds were injected with sterile water and none showed disease

symptoms with nine senescing. Further, microbes were not detected from embryo

tissue plated on TSA or TSA amended with Rif. Thus, buds punctured with a

31 gauge needle and injected with sterile water were generally tolerant to the

trauma (Figure 1(a)). Conversely, all 50 of the buds inoculated with strain CFH

7-1R became diseased (Figure 1(b) and Figure 1(c)) with 19 falling from the

plant. The bacterial concentration range on both TSA and TSA amended with

Rif was 106 - 108 CFU/g tissue indicating that strain CFH 7-1R was both responsible

for the infection and the only microorganism present. Therefore, simulated

fleahopper inoculation tests showed that the strain CFH 7-1R alone was capable

of causing both blight and abscission of inoculated buds (Figure 1(b) and Figure

1(c)). These data suggested that bud blighting may be due to multiple effects

including both the previously reported fleahopper feeding induced ethylene

bursts [5] and bacterial pathogens deposited during insect enzyme egestion.

3.2. Caging Insects with Cotton

                                               
Figure 1. Effects of the introduction of bacterial strain CFH 7-1R into cotton buds via

simulated cotton fleahopper puncture inoculation. Simulated cotton fleahopper feeding

consisted of inoculation of water or a suspension of strain CFH 7-1R in water at 103 CFU

into cotton buds using a 31 gauge needle. Insects harboring strain CFH 7-1R were caged

with cotton fruiting branches for seven days. All the buds were harvested seven days after

treatments and resulted in the absence of disease if water was used (a). Conversely, tissue

necrosis always occurred if CFH 7-1R was puncture inoculated using a needle (b) (c)

Figure 2. Cross section of cotton flower bud showing rot of ovary

wall and damage to anthers following exposure to laboratory reared

cotton fleahoppers.

mm), all were blighted and killed and 21 abscised with 27 retained on the plant.

Fourteen of 29 large flower buds (3 to 7 mm wide) died and abscised. Bacterial

concentrations from squares that remained on the plant ranged from 105 - 108

CFU/g tissue on TSA regardless of size. Protuberances from insect feeding or

ovipositing appeared on fruiting branches, leaves and flower petals. Abscission

was consistently associated with necrosis and damage of the ovary wall (Figure

2). This symptom in abscised squares has been reported previously [25] [26].

Both abscised and retained buds showed necrotic spots among the anthers or on

the stigma and style and are considered diagnostic for square abscissions caused

by fleahoppers [25] [27]. Damage to the ovary, however, appeared to be most

critical for inciting abscission. These results suggested that perhaps opportunistic

bacteria are transmitted vertically (i.e., from adult to egg), and thus more advanced

lab-reared generations are required to produce cotton “pathogen-free”

insects, or a range of bacteria are capable of rotting buds. We are currently exploring

each of these possibilities.

3.3. Characterization of Bacteria

The laboratory reared fleahoppers were regularly infested with opportunistic

bud infecting bacteria. Therefore, 17 isolates from fleahoppers chosen from five

insects (3 - 4 isolates/bug), 16 isolates from four diseased buds caged (4 isolates/bud)

with these insects, and strain CFH 7-1R that was used in the simulated

insect feeding studies were characterized microbiologically. From the representative

isolates, 27 were Gram-negative rods that produced yellow colonies

on TSA. Notably, yellow was the predominant pigmentation on TSA from the

original insect and plant tissue isolation plates.

Results that are typical of Pantoea species are shown for nine isolates which

are compared with the type strains of P. agglomeans and P. ananatis in Table 1.

All of the putative Pantoea (n = 27) isolates were more similar to P. ananatis

.

Support for Rural America from the Ground

The White House Rural Council: Support for Rural America from the Ground Up

In 1975, I graduated law school and moved with my wife Christie to her home state of Iowa. We chose Mount Pleasant, a town of about 8,000 people in the southeast part of the State, and it was during this early time in my career, as a private citizen, that I first saw how people in small towns and rural places work together to move their communities forward.

Mount Pleasant had a youth athletic facility that was in desperate need of repair, and time and time again, the City Council refused to pass a bond bill to pay for what was needed. So my neighbors and I took matters into our own hands, holding a radio pledge drive and raising over $200,000 in just a few days. We were still short of the funds we needed, so in true Iowa fashion, others stepped up.

Local businesses donated funds and supplies, while community members volunteered their time on nights and weekends to do the repairs themselves. Soon enough, Mount Pleasant had a beautiful new athletic facility for our children and our children’s children to enjoy. Through this experience, I came to understand that when communities come together around a common goal, the sky is the limit.

President Obama understands this too. The time he spent as an organizer on the South Side of Chicago taught him that more often than not, lasting change starts at the community level, and grows from the ground up. He has advanced a new approach to Federal engagement with local communities, moving away from an outdated, one-size-fits-all approach toward a more tailored model that is directed by the community’s vision, leverages local assets and responds to specific barriers. This approach has driven our work with rural communities. Over the course of this Administration, we’ve collaborated with rural leaders across the country to provide targeted Federal resources that advance their communities’ goals.

To understand the impact we’ve made with this approach, it is important to understand the economic hole we were in at the depths of the Great Recession. Rural counties were shedding 200,000 jobs per year, rural unemployment stood at nearly 10 percent and poverty rates reached heights not seen in decades. Equally concerning as the economic trends were the structural changes; widespread job losses coupled with an increasing shift to a technology-focused economy spurred outward migration and left many rural communities ill-positioned to bounce back quickly.

With all of that in mind, in 2011, the President took a historic step toward making the Federal government a more effective partner to rural communities: He created the first ever White House Rural Council. The Council, whose members include nearly every member of the Cabinet and senior White House staff, has worked across entrenched lines in the Federal government to provide first-of-their-kind comprehensive resources targeted specifically for rural communities as well as serve as the front door of the White House for rural stakeholders to engage and partner with the Administration.

Specifically, the Council coordinates the Administration’s efforts in rural America by performing three core functions:

1.Streamlining and improving the effectiveness of Federal programs serving rural America.

2.Engaging stakeholders, including farmers, ranchers and local citizens, on issues and solutions in rural communities.

3.
Promoting and coordinating private-sector partnerships.

Through the work of the White House Rural Council agencies and our community partners, we’ve been able to develop new programs, rooted in community partnerships and interagency collaboration, which have made a real difference for rural Americans. These programs have helped rural families find good-paying jobs, grow their businesses and regain a sense of economic security by focusing on sustainable economic solutions.

                     Study in the USA

USA has the world’s largest international student population, with over 800,000 students choosing to broaden their education and life experience in the United States. Nearly 4% of all students enrolled in higher-level education in the USA are international students, and the numbers are growing. From the mid-1950’s, when international student enrollment was only just reaching 35,000, international education in the USA has come a long way.

We look forward to helping students who, like you, are considering continuing your education in the United States. You will find all of the tools you need to compile your necessary research in deciding if the United States is the best place for you — we have gathered valuable information on educational, social, cultural and economic aspects of studying in the U.S.

USA/State

Choosing the USA

There are many reasons that students like to come to the USA to study at the undergraduate and graduate level — learn more about what the USA has to offer an international student. This section will help you focus on the main factors that students should consider when deciding whether to pursue an education in the USA. Learn More

USA State Guides

The USA is a vast country, and every state is unique in its culture, climate, history, economy and more. New York is very different than Alaska. Our state guides provide complete state by state information, including that state’s popularity amongst international students, to help guide your decision as to where in the US you should study. Learn More

Preparation for your stay

All the necessities of life that you have at home, you will have to recreate for your stay in the USA. Do you have your student visa, travel essentials and enough cash to get set up? Have you purchased an international student insurance plan? Are you set up to call home regularly and affordably? Make sure you are fully prepared before you leave for the USA.Learn More

Studying in the US

College & University Search

Find, research, contact and save schools you are interested in through our USA School Search. With listings of all universities and colleges in the USA that accept and enroll international students, once you create a free account it can be your central place to find the right school for you! With searchable data on over 3,000 schools, you can match to schools based on program of study and degree, state or other geographical location, tuition range, public vs. private and many other data points. We know that choosing the right school and program can be an extensive and exhausting process, and we have built this resource specifically so that you, an international student, can find the right program. Learn More

Subject Study Guides

Most students have some idea of what they would like to study – whether engineering, business, law, philosophy or anything else. Our Subject Study Guide offers subject-specific information for over 50 fields of study. No matter where your interests may lie – from Agriculture to Web Design and everything in between - we have information to help. Learn More

Application Process

The application process for US colleges and universities can be extensive and confusing, and many international students are intimidated by the number of steps required. From SATs, TOEFL and other tests, to essay writing, credential evaluation and more, we have created an easy-to-follow timeline and breakdown to help you through the application process. Learn More

Financial Aid for the USA

Financing an international education is not easy, and our financial aid resources are always popular. With tips on planning, a comprehensive international scholarship database, an award-winning international financial aid blog, and custom-built international student loan application, we can help you manage your finances effectively while studying in the USA. Learn More

Religious Schools in the US

International students looking for a unique, religious experience will soon learn that there are many religious schools spread throughout the United States. Whether you are looking for a Catholic university, a Bible college or any other affiliation, we can help you research and find the perfect institution that combines spirituality with a degree in the US.Learn More

Online Degree Programs

Many schools now offer their students the opportunity to earn a degree online from anywhere in the world. For many students that cannot afford to leave home for years, online learning is the only way to earn a US degree. Learn the advantages and disadvantages of completing an online degree in your chosen field of study. Learn More

Graduation

You have many choices to make after you graduate. Will you take advantage of optional practical training and look for a job? Or do you plan to continue on with your education by seeking an advanced degree? We can help focus your research and thinking on the next step for you to take on your educational and career journey. Learn More

---

For those of you who are looking for more specific information about a particular course of study, check out our study centers that cover some of the main topics such as law, information technology, engineering, business, and more! Learn more about the application process, courses and degree programs, career opportunities and more!

The USA "Way of Life"

What will life be like for you while you are studying in the U.S.? Are you thinking of working while you study abroad? What about the challenges of living with a roommate from another country? Here you can learn more about the diverse cultural, social and economic aspects of living, studying and working in the United States. Learn More

              Study Agriculture in the US

Agriculture was once thought to be about the ancient practice of farming, but in today's world it is now regarded as cutting edge technology. Agriculture is a very broad field that seeks to help solve the world's problems in relation to hunger, health issues, and improving the quality of living, as well as increasing the quantity of food for our growing population.

Do you know what it takes to get a glass of milk on your table? Do you want to abolish obesity in the developed world and malnutrition in developing countries? Do you want to figure out how food production will keep pace with the world's population growth? Or do you feel a special connection to the land and want to work with animals and plants on a regular basis?

If you answered yes to any of these questions, then agriculture may just be the perfect fit for you.

Study of agriculture in the US

Students who study agriculture in the US will have a distinct advantage over students who study agriculture elsewhere. The US is a world leader in agricultural science and serves as an important role model for countries around the world seeking to address global food challenges. The United States utilizes some of the most advanced agricultural technology in the world, and students who study here have the opportunity to work with and learn from this technology. This is particularly valuable for students whose home countries suffer from hunger issues, as these students can bring what they learn in the United States back to their home countries and use it to teach alternative ways to grow crops and teach children about food consumption. Students who stay to find work in the US following graduation will also find their degree helpful, as there is a shortage of well-trained professionals in the agricultural field.

What to expect with a degree in agriculture

Agriculture includes the study of plants, soil, animals, research labs, nutritionists and research. There are over 30 majors within the field of agriculture as well as a number of different career opportunities. An international student has the option to pursue different degrees depending on what it is they want to do, from an Associates Degree, to a Bachelors Degree, and even a Masters Degree. Undergraduate majors (those that you pursue in your Associate or Bachelor Degree programs) include agricultural business, agricultural economics, agronomy and crop science, animal sciences, equestrian studies, farm and ranch management, food science, horticulture, soil science and sustainable agriculture. Some agriculture majors do not deal with animals at all, and instead they might find themselves focused on improving the soil of a football field!

What do you need to be highly qualified

A person going into this field must have moderate skills in communication and leadership, basic skills in interpersonal relations, and highly developed skills in mathematics, mechanical technology and sciences. Recommended high school (secondary school) classes include three lab sciences (including biology and chemistry, advanced biology is recommended if available), two to three years of a foreign language, four years of language arts and four years of math (including precalculus and calculus). Some college courses will require you to enroll in the following classes once you've declared your major, so it's important to be prepared:

• Agriculture and Environmental Ethics
• Biology
• Chemistry
• Accounting
• Nutrition
• Soil Science
• Livestock Management
• Genetics

What can you do with a major in agriculture

With a degree in agriculture you can be a manager of a farm or ranch, a technician, consultant, scientist, animal breeder, crop production technician, farmer, health and regulatory inspector, soil conservationist, and aquaculturist, just to name a few of the careers. Students pursuing this field should also realize that it is highly likely that you'll be working outside most of the day, which in some cases can be physically demanding or hazardous.

What colleges to look for

Preferred colleges are those that are considered land-grant universities. Land-grant universities are state schools that combine research, teaching and outreach — in many cases these big state schools dominate agricultural education.

International students who want to study agriculture in the US will find that there are many colleges and universities that offer programs in agriculture. It's important to think about what you want to do after graduation so that you can design a curriculum that will provide you with the skills that will allow you to be competitive in your career. Farmers require a different skill set compared to horticulturalist. Hours and working conditions also vary by occupation. As a whole, most students who study agriculture should be proficient in business, science and math.

---

 Learn more about studying agriculture in the USA by reading our growing article collection:

• Is a Degree in Agriculture Right for You?
• What to Expect When Studying Agriculture in the US
• Careers for Agriculture Majors
• Earning a Degree in Agriculture
• Agricultural Internships

« Study Guide by Subject 

Over time we will be updating this section and including more information for those who want to study agriculture in the USA and for other countries, but please feel free to post your thoughts and comments on our Facebook fan page or Google Circle, and also follow us and post questions through Twitter.

Benefit of Adding Ammonium Sulfate or Additional Glyphosate to Glyphosate in Corn and Soybean

Benefit of Adding Ammonium Sulfate or Additional Glyphosate to Glyphosate in Corn and Soybean

Nader Soltani1, Robert E. Nurse2, Christy Shropshire1, Peter H. Sikkema1

1 University of Guelph Ridgetown Campus, Ridgetown, Canada 2 Agricuture and Agri-Food Canada, Harrow, Canada

Abstract Nine field trials (4 in corn and 5 in soybean) were conducted over 2 years (2014 and 2015) to determine if there is greater benefit of adding ammonium sulfate (AMS) (2.5 L∙ha−1 ) or an equal dollar value of glyphosate (406 g∙ae∙ha−1 ) to glyphosate applied at 450, 675 or 900 g∙ae∙ha−1 for weed control in corn and soybean. Glyphosate applied at 450 g∙ae∙ha−1 controlled velvetleaf 90% to 98%, common ragweed 80% - 97%, common lambsquarters 91% - 99%, Eastern black nightshade 83% - 100% and barnyardgrass 73% - 97% in corn and common ragweed 37% - 89%, common lambsquarters 39% - 98%, barnyardgrass 90% - 98% and green foxtail 91% - 98% in soybean. The addition of AMS to glyphosate applied at 450, 675 or 900 g∙ae∙ha−1 provided little to no added benefit for the control of velvetleaf, common ragweed, common lambsquarters, Eastern black nightshade, barnyardgrass and green foxtail in corn and soybean. There was a greater benefit in weed control efficacy by simply adding and equal dollar value of glyphosate (406 g∙ae∙ha−1 ) than AMS (2.5 L∙ha−1 ) to glyphosate. There was no difference in corn or soybean yield among the herbicide treatments evaluated. Based on these results, addition of AMS to glyphosate at rates evaluated had little benefit on weed control efficacy or yield of corn and soybean. Keywords Abutilon theophrasti, Ambrosia artemisiifolia, Corn (Zea mays), Chenopodium album, Echinochloa crus-galli, Efficacy, Glyphosate, Setaria viridis, Soybean (Glycine max), Yield 1. Introduction The Ontario corn and soybean industry covers about 2,000,000 ha, and has annual

farm-gate value of approximately $3.3 billion [1]. Development of management strategies for the control of weeds in corn and soybean has been voted as the number one research priority by the Ontario Weed Committee (the voting members of the Ontario Weed Committee are representatives of the commodity groups such as corn, soybean, wheat and edible beans, industry personnel and public research scientists). Losses due to weeds include reduced yield, decreased quality, reduced field efficiency, and greater losses due to spoilage, increased dockage at the point of sale, and potential rejection of the crop. Currently, more than 90% of the corn and 79% of soybean produced in Ontario are seeded to glyphosate-resistant hybrids/cultivars [2]. Glyphosate-resistant corn and soybean provide Ontario crop producers cost-effective weed management options that are efficacious and environmental friendly [3]. The net economic benefit to farmers is the main reason for wide adoption of this technology by crop producers in eastern Canada [4]. Despite glyphosate broad spectrum weed control, inconsistencies in control of some weed species have been reported at some locations which have been associated with water carrier solution [5] [6]. Nurse et al. [7] has shown benefit of adding AMS to glyphosate at low dose (225 g∙ha−1 ) shortly after application (7 DAA) for control of velvetleaf (Abutilon theophrasti Medic.), however, at the same time there were no benefit for control of common lambsquarters (Chenopdium album L.), redroot pigweed (Amaranthus retroflexus L.), and annual grasses such as foxtails (Setaria spp.). It has been proposed that in the presence of AMS, the sulfate ion, 2 SO4 − binds with Ca2+ to form CaSO4 and prevents formation of a Ca-salt of glyphosate, which is poorly absorbed by the leaves [6]. Instead NH4 + binds with the glyphosate molecule which results in greater absorption of glyphosate into the leaves and therefore improves weed control [6]. Limited information exists on the effect of ammonium sulfate added to glyphosate in corn and soybean under Ontario environmental conditions which can lead to unnecessary expenditures. The objectives of this research were to determine the benefit of adding ammonium sulfate or an equal dollar value of glyphosate (406 g∙ae∙ha−1 ) to glyphosate applied at 450, 675 or 900 g∙ae∙ha-1 for weed control in corn and soybean. 2. Materials and Methods Four field trials (1 at Harrow in 2014 and 3 at Ridgetown in 2015) in corn and 5 field trials in soybean (1 at Harrow in 2014, 1 at Exeter in 2014 and 3 at Ridgetown in 2015) were conducted at the Agriculture and Agri-Food Canada Research Station, Harrow, Ontario, Huron Research Station, Exeter, Ontario and University of Guelph, Ridgetown Campus, Ridgetown, Ontario. The soil ranged from sandy loam to clay loam with 30% to 83% sand, 5% to 36% silt, and 13% to 33% clay, with 2.6% to 5.6% organic matter content and pH 6.0 to 7.4. Seedbed preparation included fall mouldboard plowing followed by two passes with a field cultivator with rolling basket harrows in the spring. Studies were established as a randomized complete block design with four replica-

tions. Treatments for corn and soybean trials were the same and are listed in Tables 1-9. Weed-free control was maintained weed-free by hand hoeing as needed. Each plot was 3 m wide and 8 or 10 m long and consisted of four rows of glyphosate resistant corn/soybean spaced 0.75 m apart. Corn was planted at a rate of approximately 75,000 seeds∙ha−1 in May of each year. Soybean was planted at a rate of approximately 370,000 seeds∙ha−1 in May to early June of each year. Herbicide treatments were applied using a CO2-pressurized backpack sprayer calibrated to deliver 200 L∙ha−1 aqueous solution at 240 kPa. The boom was 1.5 m wide with four ULD120-02 nozzles (Hypro, New Brighton, MN, USA) spaced 0.5 m apart. The herbicides were applied postemergence when weeds were approximately 10 cm in height which corresponded to the V2-4 stage for corn and V2-3 stage for soybean. Weed control was visually estimated on a scale of 0 (no control) to 100% (complete control) at 1, 2, 3, 4 and 8 weeks after herbicide application (WAT). Weed density (soybean only) and dry weight (soybean only) by species were evaluated 4 WAT by counting and cutting plants at the soil surface form 1 square meter in each plot. Plants were dried at 60 C to constant moisture and then weighed. Corn or soybean was harvested at maturity with a small plot combine, weight and moisture recorded and yields were adjusted to 15.5% and 13% seed moisture content for corn and soybean, respectively. Data were analyzed using PROC GLIMMIX in Statistical Analysis Systems Software

Table 1. Percent visible control of velvetleaf 1, 2, 3, 4 and 8 WAT in corn with various rates of glyphosate alone or with AMS or additional glyphosate equivalent to the cost of the AMS at Ridgetown ON (2014-2015)a .

Treatment Rate 1 WAT 2 WAT 3 WAT 4 WAT 8 WAT g∙ae∙ha−1 % Weedy check 0 0 0 0 0 Weed-free check 100 a 100 a 100 100 100 Glyphosate 450 90 d 97 c 98 98 98 Glyphosate + AMS 450 + 2.5 L∙ha−1 93 cd 98 bc 99 98 98 Glyphosate 956 97 bcd 99 ab 99 100 100 Glyphosate 675 96 bcd 99 bc 99 98 99 Glyphosate + AMS 675 + 2.5 L∙ha−1 98 abc 99 ab 99 98 98 Glyphosate 1181 99 ab 100 a 99 100 100 Glyphosate 900 98 abc 100 a 99 100 100 Glyphosate + AMS 900 + 2.5 L∙ha−1 99 ab 100 a 99 98 98 Glyphosate 1406 99 ab 100 a 99 99 99 a Abbreviations: AMS, ammonium sulfate; WAT, weeks after herbicide application. Means followed by the same letter within a column are not significantly different according to Fisher’s Protected LSD at P < 0.05.

 

Top Course Studies in Business Studies

A course is a program that has a number of purposes. Some students take a course to help them connect two different phases of study, while others take a course to provide professional qualifications to help improve their options in their current job.

What is a course in business studies? This program provides business fundamentals that help prepare students for more advanced studies in a particular business field. It can also provide necessary knowledge for students who plan on studying an unrelated subject but would benefit from having business essentials. Every program will vary, but examples of classes may include marketing, communication, human resources, finance, and business resources. Along with classroom lectures, students may also work on projects, conduct research, and attend symposiums featuring local and national businesses.

Students who pursue a business course benefit in a number of ways. Business skills such as problem-solving, leadership, and communication can help in many different areas. There are also a wide variety of business careers available for those who want to continue on with their studies.

Advanced Certificate in Business Statistics

InterActive is a unique and innovative distance learning platform providing professional and postgraduate qualifications 100% online.

Regardless of your geographic location, regardless of the time of day, InterActive makes achieving your education goals easy and convenient. Using cutting-edge technology, InterActive brings the best in high quality UK education to your computer screen. Studio recorded lectures feature our expert tutors and a dedicated support staff ensures that your studies proceed smoothly. InterActive allows you to get the most out of your educational experience by being completely flexible and customisable around your lifestyle.

Unique Learning Experience

InterActive delivers world class academic and professional qualifications using cutting-edge technology. However, the InterActive experience goes far beyond traditional distance or online learning. We understand that regardless of where you study, you need quality resources at your fingertips and a support network that gives you access to tutors and fellow students.

When you join InterActive you will quickly benefit from our distinct approach. You willl find yourself part of an international learning community designed to create opportunities for you to collaborate, cooperate and communicate.

Benefits of studying with InterActive

• A unique single learning portal
• Studio quality lectures
• Live classroom
• Virtual information centre
• Blended learning
• Online global learning community
• 24-hour support

Master in Agriculture Murray State University

       Master in Agriculture

                           Murray State University

Master in Agriculture

Murray State University

Master in Agriculture

The School of Agriculture offers a Master of Science program degree. The purpose of this degree is to provide an opportunity for professional agricultural personnel to obtain an education at the graduate level or to prepare for terminal degree work at the doctoral level. Faculty advisers assist students in planning an appropriate course of study to meet their individual goals and to assure a balanced program.

Location

Murray, Kentucky, USA 186 kilometers from Nashville, Tennessee

Affordable Tuition

$15,712 per year for undergraduate students

$18,444 per year for graduate students

Public University Founded in 1922

Over 90 years of experience in higher education

Student Enrollment

11,166 students from the United States and 68 countries

Academic Programs

118 programs at the bachelor’s, master’s and doctoral levels

Small Class Sizes

16 to 1 student faculty ratio

National Rankings

US News: 9th Ranked Public, Regional University

in the South

Forbes: America’s Top Colleges

Campus Life

200 Student Organizations, 8 Residence Halls, and

4 on-campus dining options

Sports

NCAA Division I sports teams, along with club and intramural teams